Upload sequences in Benchling

🎯 This guide will show you all the possible ways to upload a sequence in Benchling, including:

  • copy/pasting a sequence

  • uploading a sequence file

  • importing a sequence from a database

  • importing a chromosomal region from a database

Sequences may be plasmids, DNA fragments, genes, primers or others. After creating a sequence, you will be able to view, annotate and modify it, and perform further processing using Benchling Molecular Biology Tools. For an introduction to Benchling Molecular Biology Tools, check this guide.

Get started

Locate the sequence creation menu:

Note: Always double-check which folder you are saving to!

Create a new sequence

This can be useful for raw sequences. For example, if you have a .docx file with a sequence, or the PDF of a paper with a sequence you are interested in, you can easily copy and paste it. The menu allows you to set the topology and schema depending on what your sequence corresponds to.

Try it out!

➜ Create a file for the pCAT promoter (agaggttccaactttcaccataatgaaaca)

Upload a sequence file

If you have one or more sequences saved to your computer, you can upload them. The sequence, annotations and comments will be imported.

Try it out!

➜ Download the file for the pET-28b(+) plasmid and upload it to Benchling: pET-28b(+)

Import from databases

If you have a link or ID from a database, you can directly import the corresponding sequence into Benchling.

The following identifiers are supported:

  • Addgene URL

  • BioBrick ID

  • Ensembl ID

  • Gene name or symbol

  • iGEM Registry

  • Joint BioEnergy Institute (JBEI) ID

  • NCBI Accession Number

Try it out!

➜ Copy and paste any of these IDs into the sequence search bar:

BioBrick ID

Gene name

Addgene URL

BBa_K156014

XXT3 (Species: Arabidopsis thaliana)

Link

Select a chromosomal region

It’s also possible to import sequences from genomic loci by searching for them directly from Benchling, which uses the Ensembl database. You need to know the organism or genome ID, the chromosome and the locations of the start and the end.

Try it out!

➜ Import the human HBB gene by selecting the human genome, chromosome 11, and write 5225464 as the start and 5229395 as the end.

If you have any question, don’t hesitate to contact us at lims_support@biosustain.dtu.dk.